-
PurposeExpress pHluorin-mKate2-hLC3∆G (PK-hLC3∆G), a negative control for pHluorin-mKate2-hLC3 (PK-hLC3), in mammalian cells for monitoring autophagy, based on FUGW (3rd gen lentiviral plasmid)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61461 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFUGW
- Backbone size w/o insert (bp) 9000
- Total vector size (bp) 11000
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePK-hLC3∆G
-
Alt namepHluorin-mKate2-hLC3∆G
-
SpeciesH. sapiens (human)
-
Entrez GeneMAP1LC3B (a.k.a. ATG8F, LC3B, MAP1A/1BLC3, MAP1LC3B-a)
- Promoter hUBC
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TGTGGACAGAAGACTGGAAAG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
We thank Dr. James Edward Rothman for providing respective pHluorin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FUGW-PK-hLC3∆G was a gift from Isei Tanida (Addgene plasmid # 61461 ; http://n2t.net/addgene:61461 ; RRID:Addgene_61461) -
For your References section:
A Super-Ecliptic, pHluorin-mKate2, Tandem Fluorescent Protein-Tagged Human LC3 for the Monitoring of Mammalian Autophagy. Tanida I, Ueno T, Uchiyama Y. PLoS One. 2014 Oct 23;9(10):e110600. doi: 10.1371/journal.pone.0110600. eCollection 2014. 10.1371/journal.pone.0110600 PubMed 25340751