Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

FUGW-PK-hLC3∆G
(Plasmid #61461)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61461 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    FUGW
  • Backbone size w/o insert (bp) 9000
  • Total vector size (bp) 11000
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PK-hLC3∆G
  • Alt name
    pHluorin-mKate2-hLC3∆G
  • Species
    H. sapiens (human)
  • Entrez Gene
    MAP1LC3B (a.k.a. ATG8F, LC3B, MAP1A/1BLC3, MAP1LC3B-a)
  • Promoter hUBC

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TGTGGACAGAAGACTGGAAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

We thank Dr. James Edward Rothman for providing respective pHluorin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FUGW-PK-hLC3∆G was a gift from Isei Tanida (Addgene plasmid # 61461 ; http://n2t.net/addgene:61461 ; RRID:Addgene_61461)
  • For your References section:

    A Super-Ecliptic, pHluorin-mKate2, Tandem Fluorescent Protein-Tagged Human LC3 for the Monitoring of Mammalian Autophagy. Tanida I, Ueno T, Uchiyama Y. PLoS One. 2014 Oct 23;9(10):e110600. doi: 10.1371/journal.pone.0110600. eCollection 2014. 10.1371/journal.pone.0110600 PubMed 25340751