px335 Mettl14 sgRNA #1
(Plasmid
#61515)
-
Purposeencodes sgRNA sequence for targeting mouse Mettl14 locus (Cas9-Nickase strategy)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61515 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepx335
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegcggcagctcctagctcagc
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)20
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bbs1 (destroyed during cloning)
- 3′ cloning site Bbs1 (destroyed during cloning)
- 5′ sequencing primer TGGCCTTTTGCTCACATGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px335 Mettl14 sgRNA #1 was a gift from Jacob Hanna (Addgene plasmid # 61515 ; http://n2t.net/addgene:61515 ; RRID:Addgene_61515) -
For your References section:
Stem cells. m6A mRNA methylation facilitates resolution of naive pluripotency toward differentiation. Geula S, Moshitch-Moshkovitz S, Dominissini D, Mansour AA, Kol N, Salmon-Divon M, Hershkovitz V, Peer E, Mor N, Manor YS, Ben-Haim MS, Eyal E, Yunger S, Pinto Y, Jaitin DA, Viukov S, Rais Y, Krupalnik V, Chomsky E, Zerbib M, Maza I, Rechavi Y, Massarwa R, Hanna S, Amit I, Levanon EY, Amariglio N, Stern-Ginossar N, Novershtern N, Rechavi G, Hanna JH. Science. 2015 Feb 27;347(6225):1002-6. doi: 10.1126/science.1261417. Epub 2015 Jan 1. 10.1126/science.1261417 PubMed 25569111