Skip to main content
Addgene
Open Menu

px335 Mettl14 sgRNA #1
(Plasmid #61515)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61515 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 61515-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 61515-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    px335
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gcggcagctcctagctcagc
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    20

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bbs1 (destroyed during cloning)
  • 3′ cloning site Bbs1 (destroyed during cloning)
  • 5′ sequencing primer TGGCCTTTTGCTCACATGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px335 Mettl14 sgRNA #1 was a gift from Jacob Hanna (Addgene plasmid # 61515 ; http://n2t.net/addgene:61515 ; RRID:Addgene_61515)

  • For your References section:

    Stem cells. m6A mRNA methylation facilitates resolution of naive pluripotency toward differentiation. Geula S, Moshitch-Moshkovitz S, Dominissini D, Mansour AA, Kol N, Salmon-Divon M, Hershkovitz V, Peer E, Mor N, Manor YS, Ben-Haim MS, Eyal E, Yunger S, Pinto Y, Jaitin DA, Viukov S, Rais Y, Krupalnik V, Chomsky E, Zerbib M, Maza I, Rechavi Y, Massarwa R, Hanna S, Amit I, Levanon EY, Amariglio N, Stern-Ginossar N, Novershtern N, Rechavi G, Hanna JH. Science. 2015 Feb 27;347(6225):1002-6. doi: 10.1126/science.1261417. Epub 2015 Jan 1. 10.1126/science.1261417 PubMed 25569111
Related items:
Commonly requested with: