-
PurposeConstitutive expression of murine wild-type Mettl3
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61516 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBRPy
- Total vector size (bp) 9810
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMettl3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1743
-
Entrez GeneMettl3 (a.k.a. 2310024F18Rik, M6A, Spo8)
- Promoter CAGG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho (destroyed during cloning)
- 3′ cloning site Not (not destroyed)
- 5′ sequencing primer GGGGACGGCTGCCTTCGGGG
- 3′ sequencing primer ACAGGATGTCCCAGGCGAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBRPyCAG-Mettl3-dsRed-IRES-puro was a gift from Jacob Hanna (Addgene plasmid # 61516 ; http://n2t.net/addgene:61516 ; RRID:Addgene_61516) -
For your References section:
Stem cells. m6A mRNA methylation facilitates resolution of naive pluripotency toward differentiation. Geula S, Moshitch-Moshkovitz S, Dominissini D, Mansour AA, Kol N, Salmon-Divon M, Hershkovitz V, Peer E, Mor N, Manor YS, Ben-Haim MS, Eyal E, Yunger S, Pinto Y, Jaitin DA, Viukov S, Rais Y, Krupalnik V, Chomsky E, Zerbib M, Maza I, Rechavi Y, Massarwa R, Hanna S, Amit I, Levanon EY, Amariglio N, Stern-Ginossar N, Novershtern N, Rechavi G, Hanna JH. Science. 2015 Feb 27;347(6225):1002-6. doi: 10.1126/science.1261417. Epub 2015 Jan 1. 10.1126/science.1261417 PubMed 25569111