Pvalb-2A-Cre targeting vector
(Plasmid
#61570)
-
PurposeTarget the Cre recombinase gene to the stop codon of the mouse Pvalb gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61570 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBS SK2+
- Backbone size w/o insert (bp) 4496
- Total vector size (bp) 16469
-
Modifications to backboneContains a pPGK-DTA-bGHpA cassette, MCS region was modified
-
Vector typeMouse Targeting, Cre/Lox
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl2
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePvalb exon 4 - 2A - Cre
-
Alt nameCre
-
SpeciesM. musculus (mouse); P1 Bacteriophage
-
Insert Size (bp)11973
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn (not destroyed)
- 3′ cloning site Sac2 (not destroyed)
- 5′ sequencing primer TCTTCGCTATTACGCCAGCT
- 3′ sequencing primer AACAGCTATGACCATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Pvalb-2A-Cre targeting vector was a gift from Hongkui Zeng (Addgene plasmid # 61570 ; http://n2t.net/addgene:61570 ; RRID:Addgene_61570) -
For your References section:
Transgenic mice for intersectional targeting of neural sensors and effectors with high specificity and performance. Madisen L, Garner AR, Shimaoka D, Chuong AS, Klapoetke NC, Li L, van der Bourg A, Niino Y, Egolf L, Monetti C, Gu H, Mills M, Cheng A, Tasic B, Nguyen TN, Sunkin SM, Benucci A, Nagy A, Miyawaki A, Helmchen F, Empson RM, Knopfel T, Boyden ES, Reid RC, Carandini M, Zeng H. Neuron. 2015 Mar 4;85(5):942-58. doi: 10.1016/j.neuron.2015.02.022. 10.1016/j.neuron.2015.02.022 PubMed 25741722