Skip to main content

pcDNA 5/FR/TO-Ubl4A
(Plasmid #61810)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61810 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pc DNA 5/FR/TO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5070
  • Total vector size (bp) 5661
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    UBL4A
  • Alt name
    ubiquitin-like 4A,
  • Alt name
    GDX; G6PD; GET5; MDY2; UBL4; TMA24; DX254E; DXS254E
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    591
  • GenBank ID
    NM_014235.4
  • Entrez Gene
    UBL4A (a.k.a. DX254E, DXS254E, G6PD, GDX, GET5, MDY2, TMA24, UBL4)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA 5/FR/TO-Ubl4A was a gift from Yihong Ye (Addgene plasmid # 61810 ; http://n2t.net/addgene:61810 ; RRID:Addgene_61810)
  • For your References section:

    USP13 antagonizes gp78 to maintain functionality of a chaperone in ER-associated degradation. Liu Y, Soetandyo N, Lee JG, Liu L, Xu Y, Clemons WM Jr, Ye Y. Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14. 10.7554/eLife.01369 PubMed 24424410