Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more


(Plasmid #61882)


Item Catalog # Description Quantity Price (USD)
Plasmid 61882 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6491
  • Total vector size (bp) 8877
  • Vector type
    Mammalian Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
    Hygromycin, 50 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    XL1 Blue
  • Growth instructions
    may require extended growth time
  • Copy number

Gene/Insert 1

  • Gene/Insert name
    HER2/neu receptor specific humanized Epsilon heavy chain expression cassette
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Promoter mEF1 Prom

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TTTTGAGCGGAGCTAATTCTCGGG
  • 3′ sequencing primer AAAAAACCTCCCACACCTCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    HER2/neu receptor specific humanized kappa light chain expression cassette
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Promoter rEF1 Prom

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GAGGCTAATTCTCAAGCCTC
  • 3′ sequencing primer TCTAGACCTGGAAAGACCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVITRO1-Trastuzumab-IgE/κ was a gift from Andrew Beavil (Addgene plasmid # 61882)
  • For your References section:

    A tool kit for rapid cloning and expression of recombinant antibodies. Dodev TS, Karagiannis P, Gilbert AE, Josephs DH, Bowen H, James LK, Bax HJ, Beavil R, Pang MO, Gould HJ, Karagiannis SN, Beavil AJ. Sci Rep. 2014 Jul 30;4:5885. doi: 10.1038/srep05885. 10.1038/srep05885 PubMed 25073855