Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Nxph4-2A-CreERT2 Targeting Vector
(Plasmid #62219)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 62219 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBluescriptII SK+
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 2850
  • Total vector size (bp) 19650
  • Vector type
    Mammalian Expression, Mouse Targeting, Cre/Lox
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    low concentration Kan
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl2
  • Growth instructions
    Grow on 15 ug/ml Kanamaycin
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nxph4-2A-CreERT2
  • Alt name
    neurexophilin 4
  • Species
    M. musculus (mouse); Bacteriophage
  • Insert Size (bp)
    16800
  • Promoter Mouse Nxph4

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TCTTCGCTATTACGCCAGCT
  • 3′ sequencing primer AACAGCTATGACCATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Nxph4-2A-CreERT2 Targeting Vector was a gift from Hongkui Zeng (Addgene plasmid # 62219 ; http://n2t.net/addgene:62219 ; RRID:Addgene_62219)
  • For your References section:

    Anatomical characterization of Cre driver mice for neural circuit mapping and manipulation. Harris JA, Hirokawa KE, Sorensen SA, Gu H, Mills M, Ng LL, Bohn P, Mortrud M, Ouellette B, Kidney J, Smith KA, Dang C, Sunkin S, Bernard A, Oh SW, Madisen L, Zeng H. Front Neural Circuits. 2014 Jul 10;8:76. doi: 10.3389/fncir.2014.00076. eCollection 2014. 10.3389/fncir.2014.00076 PubMed 25071457