Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #62257)


Item Catalog # Description Quantity Price (USD)
Plasmid 62257 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    A2NT sgRNA
  • gRNA/shRNA sequence
    ataatacccgtgtgacccgtgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaa cttgaaaaagtggcaccgagtcggtgcttttttt
  • Promoter pBAD

Cloning Information

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAN-PBAD-sgRNA-A2NT was a gift from Christopher Voigt (Addgene plasmid # 62257 ; ; RRID:Addgene_62257)
  • For your References section:

    Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Nielsen AA, Voigt CA. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. PubMed 25422271