Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

NLS-HA-2xMCP-KRAB
(Plasmid #126589)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 126589 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHAGE-UbiC
  • Total vector size (bp) 7274
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    2XMCP-KRAB
  • Alt name
    2x MS2 coat protein
  • Alt name
    KRAB; KOX1 (aa14-85)
  • Species
    Synthetic
  • Promoter human ubiquitin C promoter
  • Tag / Fusion Protein
    • NLS-HA (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer hUBCpro-F2 CGCCGATGATTATATAAGGA
  • 3′ sequencing primer mTagBFP-R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NLS-HA-2xMCP-KRAB was a gift from David Segal (Addgene plasmid # 126589 ; http://n2t.net/addgene:126589 ; RRID:Addgene_126589)
  • For your References section:

    Ezh2-dCas9 and KRAB-dCas9 enable engineering of epigenetic memory in a context-dependent manner. O'Geen H, Bates SL, Carter SS, Nisson KA, Halmai J, Fink KD, Rhie SK, Farnham PJ, Segal DJ. Epigenetics Chromatin. 2019 May 3;12(1):26. doi: 10.1186/s13072-019-0275-8. 10.1186/s13072-019-0275-8 PubMed 31053162