Skip to main content

pTrex-n-eGFP
(Plasmid #62544)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 62544 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pTrex-n
  • Backbone manufacturer
    http://dx.doi.org/10.1016/S0378-1119(99)00386-8
  • Backbone size w/o insert (bp) 6196
  • Total vector size (bp) 6916
  • Vector type
    (1)Trypanosoma cruzi expression of eGFP (2) genome integration of eGFP
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eGFP
  • Insert Size (bp)
    720
  • Mutation
    None
  • Promoter Ribo-HX1
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TTTTCACGCACGAAAGCGAA
  • 3′ sequencing primer CTCCTTCGGCAGGTTGTTCT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    eGFP gene was subcloned from pTD4-eGFP plasmid. pTD4-eGFP plasmid was a gift from Gretchen Cooley in Dr Rick Tarleton's lab at University of Georgia
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTrex-n-eGFP was a gift from Rick Tarleton (Addgene plasmid # 62544 ; http://n2t.net/addgene:62544 ; RRID:Addgene_62544)
  • For your References section:

    CRISPR-Cas9-Mediated Single-Gene and Gene Family Disruption in Trypanosoma cruzi. Peng D, Kurup SP, Yao PY, Minning TA, Tarleton RL. MBio. 2014 Dec 30;6(1). pii: e02097-14. doi: 10.1128/mBio.02097-14. 10.1128/mBio.02097-14 PubMed 25550322