Skip to main content

pAB1
(Plasmid #62547)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62547 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMF54
  • Modifications to backbone
    pKK233-2 with oriT and stabilized for replication in P. aeruginosa and with lacIq.
  • Vector type
    Bacterial Expression ; broad host range plasmid
  • Selectable markers
    Ampicillin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eGFP
  • Alt name
    GFP mut2
  • Promoter pTrc

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer CAATTTCACACAGGAAACAGA
  • 3′ sequencing primer TCAGGCTGAAAATCTTCTCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAB1 was a gift from Michael Franklin (Addgene plasmid # 62547 ; http://n2t.net/addgene:62547 ; RRID:Addgene_62547)
  • For your References section:

    Contributions of antibiotic penetration, oxygen limitation, and low metabolic activity to tolerance of Pseudomonas aeruginosa biofilms to ciprofloxacin and tobramycin. Walters MC 3rd, Roe F, Bugnicourt A, Franklin MJ, Stewart PS. Antimicrob Agents Chemother. 2003 Jan;47(1):317-23. PubMed 12499208