Skip to main content

pOTTC814 - pAAV-SYN1-CRTsigpep-GCaMP3 (D324G+D360G+397G+D435G 10.19)-KDEL
(Plasmid #63887)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63887 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    Addgene Plasmid #50465
  • Backbone manufacturer
    Bryan Roth
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ER-localized low-affinity GCaMP3(10.19)
  • Species
    Synthetic
  • Promoter human SYN1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site bamhi (unknown if destroyed)
  • 3′ cloning site ecori (unknown if destroyed)
  • 5′ sequencing primer hSYN1 F417 actcagcgctgcctcagtct
  • 3′ sequencing primer WPRE_R1
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC814 - pAAV-SYN1-CRTsigpep-GCaMP3 (D324G+D360G+397G+D435G 10.19)-KDEL was a gift from Brandon Harvey (Addgene plasmid # 63887 ; http://n2t.net/addgene:63887 ; RRID:Addgene_63887)
  • For your References section:

    A Low Affinity GCaMP3 Variant (GCaMPer) for Imaging the Endoplasmic Reticulum Calcium Store. Henderson MJ, Baldwin HA, Werley CA, Boccardo S, Whitaker LR, Yan X, Holt GT, Schreiter ER, Looger LL, Cohen AE, Kim DS, Harvey BK. PLoS One. 2015 Oct 9;10(10):e0139273. doi: 10.1371/journal.pone.0139273. eCollection 2015. PONE-D-15-20579 [pii] PubMed 26451944