Skip to main content

pLenti-Lifeact-tdTomato
(Plasmid #64048)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64048 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti-hiko
  • Backbone size w/o insert (bp) 9124
  • Total vector size (bp) 10768
  • Modifications to backbone
    pLenti-hiko was digested with NheI + HpaI
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lifeact
  • Alt name
    the first 17 amino acids of Abp140
  • Species
    S. cerevisiae (budding yeast), Synthetic
  • Insert Size (bp)
    51
  • Promoter Ubiquitin
  • Tag / Fusion Protein
    • tdTomato (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer GGCGAGTGTGTTTTGTGAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Lifeact sequence was initially reported in Riedl, J. et al. Lifeact: a versatile marker to visualize F-actin. Nat Methods 5, 605–607 (2008).

Please cite the following article as follows:
Lim, C.-Y. et al. Tropomodulin3 is a novel Akt2 effector regulating insulin-stimulated GLUT4 exocytosis through cortical actin remodeling. Nat Commun 6, 5951 (2015).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-Lifeact-tdTomato was a gift from Weiping Han (Addgene plasmid # 64048 ; http://n2t.net/addgene:64048 ; RRID:Addgene_64048)
  • For your References section:

    Tropomodulin3 is a novel Akt2 effector regulating insulin-stimulated GLUT4 exocytosis through cortical actin remodeling. Lim CY, Bi X, Wu D, Kim JB, Gunning PW, Hong W, Han W. Nat Commun. 2015 Jan 9;6:5951. doi: 10.1038/ncomms6951. 10.1038/ncomms6951 PubMed 25575350