Skip to main content
Addgene

pLenti-myc-GLUT4-mCherry
(Plasmid #64049)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64049 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti-hiko
  • Backbone size w/o insert (bp) 9124
  • Total vector size (bp) 11604
  • Modifications to backbone
    pLenti-hiko was digested with NheI + HpaI
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GLUT4
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1530
  • Entrez Gene
    Slc2a4 (a.k.a. GT2, Glut-4, Glut4, twgy)
  • Promoter Ubiquitin
  • Tags / Fusion Proteins
    • mCherry (C terminal on insert)
    • c-Myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer GGCGAGTGTGTTTTGTGAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The c-Myc sequence was inserted into the region encoding the 1st exofacial loop of mouse GLUT4 in the background of pmCherry-N1. The fragment of Myc-GLUT4-mCherry was then sub-cloned into pLenti-hiko vector via NheI + HpaI digestion.

Discrepancies between the Addgene QC sequence and the full sequence are not of functional concern.

Please cite the following article:
Lim, C.-Y. et al. Tropomodulin3 is a novel Akt2 effector regulating insulin-stimulated GLUT4 exocytosis through cortical actin remodeling. Nat Commun 6, 5951 (2015).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-myc-GLUT4-mCherry was a gift from Weiping Han (Addgene plasmid # 64049 ; http://n2t.net/addgene:64049 ; RRID:Addgene_64049)
  • For your References section:

    Tropomodulin3 is a novel Akt2 effector regulating insulin-stimulated GLUT4 exocytosis through cortical actin remodeling. Lim CY, Bi X, Wu D, Kim JB, Gunning PW, Hong W, Han W. Nat Commun. 2015 Jan 9;6:5951. doi: 10.1038/ncomms6951. 10.1038/ncomms6951 PubMed 25575350