-
PurposeAdenovirus for the expression of gRNAs targeting intron 19 of murine Alk and intron 14 of Eml4
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 64071 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepacAd5
-
Backbone manufacturerGene Transfer Vector Core University of Iowa
- Backbone size w/o insert (bp) 5679
- Total vector size (bp) 11538
-
Vector typeAdenoviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameU6_sgRNA(Alk)_U6_sgRNA(Eml4)_CBh_FLAG-Cas9
-
gRNA/shRNA sequenceAlk (intron 19) Eml4 (intron 14)
-
SpeciesM. musculus (mouse)
- Promoter U6 and CBh
-
Tag
/ Fusion Protein
- FLAG-Cas9
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GATGTTGTAGTAAATTTGGG
- 3′ sequencing primer ATCATGTCTGGATCTCCCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byU6 and Cas9 from pX330 (Zhang Lab)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Adeno EA was a gift from Andrea Ventura (Addgene plasmid # 64071 ; http://n2t.net/addgene:64071 ; RRID:Addgene_64071) -
For your References section:
In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system. Maddalo D, Manchado E, Concepcion CP, Bonetti C, Vidigal JA, Han YC, Ogrodowski P, Crippa A, Rekhtman N, de Stanchina E, Lowe SW, Ventura A. Nature. 2014 Dec 18;516(7531):423-7. doi: 10.1038/nature13902. Epub 2014 Oct 22. 10.1038/nature13902 PubMed 25337876