Skip to main content

pGATOR
(Plasmid #64102)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64102 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBR322
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 23453
  • Vector type
    Mammalian Expression, Mouse Targeting ; Tet Inducible
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    rTTA
  • Species
    Synthetic
  • Insert Size (bp)
    1026
  • Entrez Gene
    Gt(ROSA)26Sor (a.k.a. Gtrgeo26, Gtrosa26, R26, ROSA26, Thumpd3as1)
  • Promoter ROSA26 endogenous

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GGATCTGTAGGGCGCAGTAG
  • 3′ sequencing primer AGACGATTTCGATCTGGACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The pGATOR vector was at Bill Skarnes’ lab (Sanger) and is a modification of a Rosa26 targeting vector obtained from Anton Berns’ lab (a scientist at Netherland Cancer Institute - NKI), described in this paper: A highly efficient ligand-regulated Cre recombinase mouse line shows that LoxP recombination is position dependent. (https://www.ncbi.nlm.nih.gov/pubmed/11306549) Vooijs M, Jonkers J, Berns A. EMBO Rep. 2001 Apr;2(4):292-7.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGATOR was a gift from Bill Skarnes (Addgene plasmid # 64102 ; http://n2t.net/addgene:64102 ; RRID:Addgene_64102)
  • For your References section:

    Selecting antagonistic antibodies that control differentiation through inducible expression in embryonic stem cells. Melidoni AN, Dyson MR, Wormald S, McCafferty J. Proc Natl Acad Sci U S A. 2013 Oct 29;110(44):17802-7. doi: 10.1073/pnas.1312062110. Epub 2013 Sep 30. 10.1073/pnas.1312062110 PubMed 24082130