pGATOR
(Plasmid
#64102)
-
PurposeTet inducible, Gateway adapted ROSA26 targeting Vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64102 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBR322
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 23453
-
Vector typeMammalian Expression, Mouse Targeting ; Tet Inducible
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namerTTA
-
SpeciesSynthetic
-
Insert Size (bp)1026
-
Entrez GeneGt(ROSA)26Sor (a.k.a. Gtrgeo26, Gtrosa26, R26, ROSA26, Thumpd3as1)
- Promoter ROSA26 endogenous
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGATCTGTAGGGCGCAGTAG
- 3′ sequencing primer AGACGATTTCGATCTGGACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe pGATOR vector was at Bill Skarnes’ lab (Sanger) and is a modification of a Rosa26 targeting vector obtained from Anton Berns’ lab (a scientist at Netherland Cancer Institute - NKI), described in this paper: A highly efficient ligand-regulated Cre recombinase mouse line shows that LoxP recombination is position dependent. (https://www.ncbi.nlm.nih.gov/pubmed/11306549) Vooijs M, Jonkers J, Berns A. EMBO Rep. 2001 Apr;2(4):292-7.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGATOR was a gift from Bill Skarnes (Addgene plasmid # 64102 ; http://n2t.net/addgene:64102 ; RRID:Addgene_64102) -
For your References section:
Selecting antagonistic antibodies that control differentiation through inducible expression in embryonic stem cells. Melidoni AN, Dyson MR, Wormald S, McCafferty J. Proc Natl Acad Sci U S A. 2013 Oct 29;110(44):17802-7. doi: 10.1073/pnas.1312062110. Epub 2013 Sep 30. 10.1073/pnas.1312062110 PubMed 24082130