Skip to main content

gRNA-ura-HYB
(Plasmid #64330)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64330 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRS42H
  • Backbone size w/o insert (bp) 6217
  • Total vector size (bp) 6509
  • Vector type
    Yeast Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Top10 also works
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gBlock product of ura3 deletion gRNA cassette
  • gRNA/shRNA sequence
    gagtaaaaaattgtacttgg
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer M13F
  • 3′ sequencing primer M13R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    gRNA-ura-HYB was a gift from Yong-Su Jin (Addgene plasmid # 64330 ; http://n2t.net/addgene:64330 ; RRID:Addgene_64330)
  • For your References section:

    Construction of a quadruple auxotrophic mutant of an industrial polyploid saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease. Zhang GC, Kong II, Kim H, Liu JJ, Cate JH, Jin YS. Appl Environ Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct 3. 10.1128/AEM.02310-14 PubMed 25281382