Skip to main content

7M8
(Plasmid #64839)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64839 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    XX2
  • Backbone manufacturer
    University of North Carolina Dr. Samulski
  • Backbone size w/o insert (bp) 5648
  • Total vector size (bp) 8209
  • Modifications to backbone
    replaced AAV2 cap with 7M8 cap
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    7M8 cap
  • Species
    Adeno-associated virus - 2
  • Insert Size (bp)
    2238
  • Mutation
    7mer insertion in the AAV2 cap

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GCGGAAGCTTCGATCAACTACGC
  • 3′ sequencing primer gtgcggcaaagtttgcttcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Discrepancies found during QC have no functional consequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    7M8 was a gift from John Flannery & David Schaffer (Addgene plasmid # 64839 ; http://n2t.net/addgene:64839 ; RRID:Addgene_64839)
  • For your References section:

    In vivo-directed evolution of a new adeno-associated virus for therapeutic outer retinal gene delivery from the vitreous. Dalkara D, Byrne LC, Klimczak RR, Visel M, Yin L, Merigan WH, Flannery JG, Schaffer DV. Sci Transl Med. 2013 Jun 12;5(189):189ra76. doi: 10.1126/scitranslmed.3005708. 10.1126/scitranslmed.3005708 PubMed 23761039