Flag-mScl
(Plasmid
#64895)
-
PurposeLentiviral expression of Flag-tagged murine transcription factor Scl
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64895 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePrrl-Sin-EF1
- Total vector size (bp) 7970
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameScl
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)990
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pTYF-5 (GTAGACATAATAGCAACAGAC)
- 3′ sequencing primer SV40 poly A Reverse (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Flag-mScl was a gift from Georges Lacaud (Addgene plasmid # 64895 ; http://n2t.net/addgene:64895 ; RRID:Addgene_64895) -
For your References section:
Direct reprogramming of murine fibroblasts to hematopoietic progenitor cells. Batta K, Florkowska M, Kouskoff V, Lacaud G. Cell Rep. 2014 Dec 11;9(5):1871-84. doi: 10.1016/j.celrep.2014.11.002. Epub 2014 Nov 26. 10.1016/j.celrep.2014.11.002 PubMed 25466247