-
Purpose(Empty Backbone) E. coli vector for expression of S. pyogenes dCas9, tracrRNA, and nontargeting CRISPR array with BsaI site for inserting user-defined spacer-repeat bricks
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 65006 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepdCas9-Marraffini (pACYC184)
- Backbone size (bp) 9326
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
- Promoter Constitutive native promoters
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CGCATTGATTTGAGTCAGCTAGGAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPathBrick was a gift from Mattheos Koffas (Addgene plasmid # 65006 ; http://n2t.net/addgene:65006 ; RRID:Addgene_65006) -
For your References section:
CRISPathBrick: Modular Combinatorial Assembly of Type II-A CRISPR Arrays for dCas9-Mediated Multiplex Transcriptional Repression in E. coli. Cress BF, Toparlak OD, Guleria S, Lebovich M, Stieglitz JT, Englaender JA, Jones JA, Linhardt RJ, Koffas MA. ACS Synth Biol. 2015 Mar 30. 10.1021/acssynbio.5b00012 PubMed 25822415