Skip to main content

FcD265A-FLAG
(Plasmid #65420)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65420 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    gWIZ
  • Backbone manufacturer
    Genlantis
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 6000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FcD265A-FLAG
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    810
  • Mutation
    D265A
  • Promoter Modified CMV Promoter
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GCCACCAGACATAATAGCTGAC
  • 3′ sequencing primer GCTCTGATCTTTTATTAGCCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FcD265A-FLAG was a gift from Dane Wittrup (Addgene plasmid # 65420 ; http://n2t.net/addgene:65420 ; RRID:Addgene_65420)
  • For your References section:

    Synergistic Innate and Adaptive Immune Response to Combination Immunotherapy with Anti-Tumor Antigen Antibodies and Extended Serum Half-Life IL-2. Zhu EF, Gai SA, Opel CF, Kwan BH, Surana R, Mihm MC, Kauke MJ, Moynihan KD, Angelini A, Williams RT, Stephan MT, Kim JS, Yaffe MB, Irvine DJ, Weiner LM, Dranoff G, Wittrup KD. Cancer Cell. 2015 Apr 13;27(4):489-501. doi: 10.1016/j.ccell.2015.03.004. 10.1016/j.ccell.2015.03.004 PubMed 25873172