FcD265A-FLAG
(Plasmid
#65420)
-
PurposeMammalian expression plasmid for murine Fc-FLAG, used for monomeric Fc-IL2 production
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 65420 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonegWIZ
-
Backbone manufacturerGenlantis
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 6000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFcD265A-FLAG
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)810
-
MutationD265A
- Promoter Modified CMV Promoter
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GCCACCAGACATAATAGCTGAC
- 3′ sequencing primer GCTCTGATCTTTTATTAGCCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FcD265A-FLAG was a gift from Dane Wittrup (Addgene plasmid # 65420 ; http://n2t.net/addgene:65420 ; RRID:Addgene_65420) -
For your References section:
Synergistic Innate and Adaptive Immune Response to Combination Immunotherapy with Anti-Tumor Antigen Antibodies and Extended Serum Half-Life IL-2. Zhu EF, Gai SA, Opel CF, Kwan BH, Surana R, Mihm MC, Kauke MJ, Moynihan KD, Angelini A, Williams RT, Stephan MT, Kim JS, Yaffe MB, Irvine DJ, Weiner LM, Dranoff G, Wittrup KD. Cancer Cell. 2015 Apr 13;27(4):489-501. doi: 10.1016/j.ccell.2015.03.004. 10.1016/j.ccell.2015.03.004 PubMed 25873172