Skip to main content
Addgene

attB-GFP-Dnmt3b6-Poly(A)
(Plasmid #65532)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65532 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    attB-GFP-Poly(A)
  • Vector type
    Mammalian Expression, Mouse Targeting ; Bxb1

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Dnmt3b
  • Species
    M. musculus (mouse)
  • Mutation
    isoform 6
  • Entrez Gene
    Dnmt3b (a.k.a. MmuIIIB)
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AsiSI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer CGATCACATGGTCCTGCTGG
  • 3′ sequencing primer gtggtttgtccaaactcatc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    attB-GFP-Dnmt3b6-Poly(A) was a gift from Sebastian Bultmann (Addgene plasmid # 65532 ; http://n2t.net/addgene:65532 ; RRID:Addgene_65532)
  • For your References section:

    A modular open platform for systematic functional studies under physiological conditions. Mulholland CB, Smets M, Schmidtmann E, Leidescher S, Markaki Y, Hofweber M, Qin W, Manzo M, Kremmer E, Thanisch K, Bauer C, Rombaut P, Herzog F, Leonhardt H, Bultmann S. Nucleic Acids Res. 2015 May 24. pii: gkv550. 10.1093/nar/gkv550 PubMed 26007658