-
Purposeexpresses human codon-optimised TEV protease
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65800 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5523
- Total vector size (bp) 6280
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameV5-human TEV
-
SpeciesSynthetic
-
Mutationcodon-optimised to express in mammalian cells
- Promoter CMV
-
Tag
/ Fusion Protein
- V5 (N terminal on insert)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer taatacgactcactataggg
- 3′ sequencing primer tagaaggcacagtcgagg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycustom synthesized by BioNexus
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-V5-hTEV was a gift from Douglas Green (Addgene plasmid # 65800 ; http://n2t.net/addgene:65800 ; RRID:Addgene_65800) -
For your References section:
Inducible dimerization and inducible cleavage reveal a requirement for both processes in caspase-8 activation. Oberst A, Pop C, Tremblay AG, Blais V, Denault JB, Salvesen GS, Green DR. J Biol Chem. 2010 May 28;285(22):16632-42. doi: 10.1074/jbc.M109.095083. Epub 2010 Mar 22. 10.1074/jbc.M109.095083 PubMed 20308068