Skip to main content
Addgene

pcDNA3.1-V5-hTEV
(Plasmid #65800)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65800 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5523
  • Total vector size (bp) 6280
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    V5-human TEV
  • Species
    Synthetic
  • Mutation
    codon-optimised to express in mammalian cells
  • Promoter CMV
  • Tag / Fusion Protein
    • V5 (N terminal on insert)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer taatacgactcactataggg
  • 3′ sequencing primer tagaaggcacagtcgagg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    custom synthesized by BioNexus
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-V5-hTEV was a gift from Douglas Green (Addgene plasmid # 65800 ; http://n2t.net/addgene:65800 ; RRID:Addgene_65800)
  • For your References section:

    Inducible dimerization and inducible cleavage reveal a requirement for both processes in caspase-8 activation. Oberst A, Pop C, Tremblay AG, Blais V, Denault JB, Salvesen GS, Green DR. J Biol Chem. 2010 May 28;285(22):16632-42. doi: 10.1074/jbc.M109.095083. Epub 2010 Mar 22. 10.1074/jbc.M109.095083 PubMed 20308068