pJZC42
(Plasmid
#66564)
-
PurposesgRNA + 1XPP7 with PCP-VP64 effector for mammalian cells, marked by mCherry
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 66564 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSico
-
Vector typeMammalian Expression
-
Selectable markersmCherry fluorescence
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namesgRNA + 1XPP7
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer gagatccagtttggttagtaccggg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePCP-VP64 IRES mCherry
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TTGGTCACCTTCAGCTTGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJZC42 was a gift from Wendell Lim & Stanley Qi (Addgene plasmid # 66564 ; http://n2t.net/addgene:66564 ; RRID:Addgene_66564) -
For your References section:
Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Zalatan JG, Lee ME, Almeida R, Gilbert LA, Whitehead EH, La Russa M, Tsai JC, Weissman JS, Dueber JE, Qi LS, Lim WA. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. 10.1016/j.cell.2014.11.052 PubMed 25533786