pLV floxed hMyoD-IRES-dsRed
(Plasmid
#66632)
-
Purposeco-expresses CRE excisable human MyoD and dsRed
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66632 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFUGW
- Total vector size (bp) 11500
-
Vector typeLentiviral, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman MyoD IRES dsRed
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2200
-
Entrez GeneMYOD1 (a.k.a. CMYP17, MYF3, MYOD, MYODRIF, PUM, bHLHc1)
- Promoter hUbC
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGTACAGTGCAGGGGAAAGA
- 3′ sequencing primer GGCATTAAAGCAGCGTATCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV floxed hMyoD-IRES-dsRed was a gift from Charles Gersbach (Addgene plasmid # 66632 ; http://n2t.net/addgene:66632 ; RRID:Addgene_66632)