pAAV Syn hBE Rh Guanylyl Cyclase1 2A tDimer
(Plasmid
#66779)
-
PurposeThe rhodopsin-guanylyl cyclase of the aquatic fungus Blastocladiella emersonii enables fast optical control of cGMP signaling
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 66779 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4562
- Total vector size (bp) 7964
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namehbeRhGC
-
Alt namehumanized Rhodopsin Guanylyl Cyclase 1
-
Alt namefungal rhodopsin guanylyl cyclase
-
SpeciesBlastocladiella emersonii
-
Insert Size (bp)1878
-
GenBank IDKP731361 KF309499
- Promoter human Synapsin
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG;CTGCGGAGTAGAAAAAGC;GCCAGAAACCCAGAGAAGA;GCGGCCTGAGGTGGATTCG;GACGCTTATCTGGGAGTG
- 3′ sequencing primer CGCTCCCACTTGAAGCCCTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namered fluorescent protein
-
Alt nametDimer 2
-
SpeciesDiscoma sp.
-
Insert Size (bp)1395
- Promoter human Synapsin
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ggcagaggaagtcttctaacat
- 3′ sequencing primer gtaatccagaggttgattatcg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhBE Rh GC originally from P.Hegemann-HU-Berlin Germany tDimer originally from R.Tsien USD USA
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV Syn hBE Rh Guanylyl Cyclase1 2A tDimer was a gift from Thomas Oertner (Addgene plasmid # 66779 ; http://n2t.net/addgene:66779 ; RRID:Addgene_66779) -
For your References section:
The rhodopsin-guanylyl cyclase of the aquatic fungus Blastocladiella emersonii enables fast optical control of cGMP signaling. Scheib U, Stehfest K, Gee CE, Korschen HG, Fudim R, Oertner TG, Hegemann P. Sci Signal. 2015 Aug 11;8(389):rs8. doi: 10.1126/scisignal.aab0611. 10.1126/scisignal.aab0611 PubMed 26268609