Skip to main content

NmCitrine-PHdomain
(Plasmid #66783)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 66783 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCS2+8
  • Backbone manufacturer
    Addgene Plasmid #3493, Gökirmak et al. 2012, JBC
  • Backbone size w/o insert (bp) 4851
  • Vector type
    Mammalian Expression ; sea urchin, zebrafish, xenopus

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PLCdelta
  • Alt name
    PLCD1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    529
  • Mutation
    only contains PH domain
  • Entrez Gene
    PLCD1 (a.k.a. NDNC3, PLC-III)
  • Promoter SP6
  • Tag / Fusion Protein
    • mCitrine (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site FseI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer SP6
  • 3′ sequencing primer TGTTGTTAACTTGTTTATTGCAGCT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene plasmid 21179 was used for PH domain sequence

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NmCitrine-PHdomain was a gift from Amro Hamdoun (Addgene plasmid # 66783 ; http://n2t.net/addgene:66783 ; RRID:Addgene_66783)
  • For your References section:

    Migration of sea urchin primordial germ cells. Campanale JP, Gokirmak T, Espinoza JA, Oulhen N, Wessel GM, Hamdoun A. Dev Dyn. 2014 Jul;243(7):917-27. doi: 10.1002/dvdy.24133. Epub 2014 Apr 30. 10.1002/dvdy.24133 PubMed 24677545