This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pPHT-PIP2
(Plasmid #60937)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60937 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUB2.1
  • Total vector size (bp) 8093
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PIP2 dimerization dependent sensor RA+B monomers
  • Species
    Synthetic
  • Insert Size (bp)
    2604
  • Promoter CMV
  • Tag / Fusion Protein
    • dimerization dependent fluorescent protein monomers RA+B

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer atggtgagcaagagcgaggag
  • 3′ sequencing primer ctggatgttgagctccttcaggaag
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The dimerization-dependent fluorescent protein component of the plasmid was received from Robert Campbell and was originally described in the manuscript below. Alford, S.C., Abdelfattah, A.S., Ding, Y., and Campbell, R.E. (2012). A fluorogenic red fluorescent protein heterodimer. Chem. Biol. 19, 353-360.
  • Terms and Licenses

Depositor Comments

Contains a dimerization dependent fluorescent protein, originally described by Alford, S.C., Ding, Y., Simmen, T., and Campbell, R.E. (2012). Dimerization-Dependent Green and Yellow Fluorescent Proteins. ACS Synth. Biol. 1, 569–575.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPHT-PIP2 was a gift from Anne Marie Quinn (Addgene plasmid # 60937)
  • For your References section:

    Ratiometric biosensors based on dimerization-dependent fluorescent protein exchange. Ding Y, Li J, Enterina JR, Shen Y, Zhang I, Tewson PH, Mo GC, Zhang J, Quinn AM, Hughes TE, Maysinger D, Alford SC, Zhang Y, Campbell RE. Nat Methods. 2015 Jan 26. doi: 10.1038/nmeth.3261. 10.1038/nmeth.3261 PubMed 25622108