-
Purpose2nd generation lentiviral transfer plasmid. Expresses human MYT1L with G418 resistance
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 66809 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneN174
-
Backbone manufacturerHomemade
- Backbone size w/o insert (bp) 8865
- Total vector size (bp) 12420
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMYT1L
-
Alt nameNZF1
-
SpeciesH. sapiens (human)
-
GenBank IDNM_015025.2
-
Entrez GeneMYT1L (a.k.a. MRD39, NZF1, ZC2H2C2, ZC2HC4B, myT1-L)
- Promoter Human EF1a
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGCACTTGATGTAATTCTCCTTG
- 3′ sequencing primer GTGGATGTGGAATGTGTGCGA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
phMYT1L-N174 was a gift from Andrew Yoo (Addgene plasmid # 66809 ; http://n2t.net/addgene:66809 ; RRID:Addgene_66809) -
For your References section:
MicroRNA-based conversion of human fibroblasts into striatal medium spiny neurons. Richner M, Victor MB, Liu Y, Abernathy D, Yoo AS. Nat Protoc. 2015 Oct;10(10):1543-55. doi: 10.1038/nprot.2015.102. Epub 2015 Sep 17. 10.1038/nprot.2015.102 PubMed 26379228