P119 C-Check
(Plasmid
#66817)
-
PurposeDual-fluorescent surrogate reporter vector for in vitro functional assay of programable DNA nuclease and enrichment of genetically edited cells
-
Depositing Lab
-
Depositing OrganizationAarhus University
Located in Denmark -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 66817 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 66817-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 66817-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCR8
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2575
- Total vector size (bp) 7120
-
Modifications to backboneno
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametruncated Enhanced Green Fluorescent Protein and asRED
-
Alt nameEGFP, asRED
-
Alt nameC-Check
-
SpeciesSynthetic
-
Insert Size (bp)4545
- Promoter PGK and CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer TTGATGCCTGGCAGTTCCCT
- 3′ sequencing primer CGAACCGAACAGGCTTATGT
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 66817-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 66817-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
P119 C-Check was a gift from Yonglun Luo (Addgene plasmid # 66817 ; http://n2t.net/addgene:66817 ; RRID:Addgene_66817) -
For your References section:
Enhanced genome editing in mammalian cells with a modified dual-fluorescent surrogate system. Zhou Y, Liu Y, Hussmann D, Brogger P, Al-Saaidi RA, Tan S, Lin L, Petersen TS, Zhou GQ, Bross P, Aagaard L, Klein T, Ronn SG, Pedersen HD, Bolund L, Nielsen AL, Sorensen CB, Luo Y. Cell Mol Life Sci. 2016 Jan 11. 10.1007/s00018-015-2128-3 [pii] PubMed 26755436
Map uploaded by the depositor.
