P119 C-Check
(Plasmid
#66817)
-
PurposeDual-fluorescent surrogate reporter vector for in vitro functional assay of programable DNA nuclease and enrichment of genetically edited cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 66817 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCR8
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2575
- Total vector size (bp) 7120
-
Modifications to backboneno
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametruncated Enhanced Green Fluorescent Protein and asRED
-
Alt nameEGFP, asRED
-
Alt nameC-Check
-
SpeciesSynthetic
-
Insert Size (bp)4545
- Promoter PGK and CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer TTGATGCCTGGCAGTTCCCT
- 3′ sequencing primer CGAACCGAACAGGCTTATGT
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
P119 C-Check was a gift from Yonglun Luo (Addgene plasmid # 66817 ; http://n2t.net/addgene:66817 ; RRID:Addgene_66817) -
For your References section:
Enhanced genome editing in mammalian cells with a modified dual-fluorescent surrogate system. Zhou Y, Liu Y, Hussmann D, Brogger P, Al-Saaidi RA, Tan S, Lin L, Petersen TS, Zhou GQ, Bross P, Aagaard L, Klein T, Ronn SG, Pedersen HD, Bolund L, Nielsen AL, Sorensen CB, Luo Y. Cell Mol Life Sci. 2016 Jan 11. 10.1007/s00018-015-2128-3 [pii] PubMed 26755436