Skip to main content
Addgene

pDD284
(Plasmid #66825)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 66825 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19 (modified)
  • Backbone size w/o insert (bp) 2600
  • Total vector size (bp) 10500
  • Modifications to backbone
    Addition of ccdB markers to facilitate homology arm cloning
  • Vector type
    Worm Expression, Cre/Lox, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Turbo
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TagRFP-T-C1^SEC^3xFlag
  • Species
    C. elegans (nematode), Synthetic
  • Insert Size (bp)
    6600
  • Tags / Fusion Proteins
    • C. elegans codon-optimized TagRFP-T
    • 3xFlag

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer M13 Forward (tgtaaaacgacggccagt)
  • 3′ sequencing primer M13 Reverse (caggaaacagctatgaccatg)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

THE DEPOSITING LAB NO LONGER USES THIS CONSTRUCT AND RECOMMENDS pDD286 (https://www.addgene.org/70684/) The full sequence for this plasmid can still be found by clicking the link next to "Addgene Sequences" and scrolling to the bottom of the page for "Full Addgene NGS sequence".

IMPORTANT NOTE: The repeat regions in this plasmid make it susceptible to recombination. The depositing lab grows the plasmid at 30°C. You may also want to prep and digest multiple single colonies to verify that you have a clone that has not recombined.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDD284 was a gift from Bob Goldstein (Addgene plasmid # 66825 ; http://n2t.net/addgene:66825 ; RRID:Addgene_66825)
  • For your References section:

    Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette. Dickinson DJ, Pani AM, Heppert JK, Higgins CD, Goldstein B. Genetics. 2015 Jun 3. pii: genetics.115.178335. 10.1534/genetics.115.178335 PubMed 26044593