-
PurposeGenerate OCT4 mOrange reporter line without selection cassette
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66986 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneOCT4-2A-eGFP-PGKPuro plasmid (Addgene: 31938)
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 5424
- Total vector size (bp) 6135
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name2A-mOrange
-
Insert Size (bp)711
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe1 (unknown if destroyed)
- 3′ cloning site Asc1 (unknown if destroyed)
- 5′ sequencing primer CTCACTTCACTGCACTGTACTCCT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
OCT4-2A-mOrange was a gift from Danwei Huangfu (Addgene plasmid # 66986 ; http://n2t.net/addgene:66986 ; RRID:Addgene_66986) -
For your References section:
A CRISPR/Cas-Mediated Selection-free Knockin Strategy in Human Embryonic Stem Cells. Zhu Z, Verma N, Gonzalez F, Shi ZD, Huangfu D. Stem Cell Reports. 2015 May 28. pii: S2213-6711(15)00128-9. doi: 10.1016/j.stemcr.2015.04.016. 10.1016/j.stemcr.2015.04.016 PubMed 26028531