DdMCU
(Plasmid
#67642)
-
PurposeDdMCU-Flag in pACT2 vector human codon optimised
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 67642 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepACT2
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 8100
- Total vector size (bp) 9000
-
Modifications to backbonenone
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDdMCU
-
SpeciesDictyostelium discoideum
-
Insert Size (bp)900
- Promoter ADH1
-
Tag
/ Fusion Protein
- Flag tag with linker (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GACAAGCTGTGACCGTCTCC
- 3′ sequencing primer GTTTACGTCCGCTAGCTTGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DdMCU was a gift from Vamsi Mootha (Addgene plasmid # 67642 ; http://n2t.net/addgene:67642 ; RRID:Addgene_67642) -
For your References section:
Reconstitution of the mitochondrial calcium uniporter in yeast. Kovacs-Bogdan E, Sancak Y, Kamer KJ, Plovanich M, Jambhekar A, Huber RJ, Myre MA, Blower MD, Mootha VK. Proc Natl Acad Sci U S A. 2014 Jun 17;111(24):8985-90. doi: 10.1073/pnas.1400514111. Epub 2014 Jun 2. 10.1073/pnas.1400514111 PubMed 24889638