Skip to main content

pECTO
(Plasmid #67683)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 67683 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMAD2
  • Modifications to backbone
    pECTO a Gram negative/Gram positive shuttle vector derived from pMAD2 designed to integrate DNA sequences between SAOUHSC_00278 and SAOUHSC_00279 (NCTC8325 nomenclature HG003). It carries about 1kb of both sequences. A terminator introduced between the SAOUHSC_00278 and SAOUHSC_00279 sequences prevents polar effects associated with the expression of inserted genes.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    This a Gram negative/Gram positive shuttle vector with two specialized replicons and antibiotic markers. pBR322 replicon and ampicillin resistance for E. coli. pE194(ts) replicon and erythromycin resistance for S. aureus. In S. aureus, the plasmid propagates at T<30°C, it becomes a suicide vector at T>37°C.
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCCCAATATAATCATTTATCAACTCT
  • 3′ sequencing primer TCTACCTGCCTGGACAGCAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pECTO can be used for ectopic complementation or any chromosomal gene insertions in S. aureus. It allows insertions between SAOUHSC_00278 and SAOUHSC_00279, a conserved region with no detected transcription. DNA sequences are inserted in pECTO using the unique ClaI and SalI restriction sites or more practically by Gibson assembly method. pECTO derives from pMAD2.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pECTO was a gift from Philippe Bouloc (Addgene plasmid # 67683 ; http://n2t.net/addgene:67683 ; RRID:Addgene_67683)