pRosa26-EF1a-hCas9IRESneo
(Plasmid
#67987)
-
PurposeMouse Rosa26 targeting vector carrying the EF1a-hCas9-IRES-neo cassette
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67987 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBluescriptII
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 19400
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEF1a-hCas9IRESneopA
-
SpeciesSynthetic
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCTTCCCTCGTGATCTGCAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRosa26-EF1a-hCas9IRESneo was a gift from Kosuke Yusa (Addgene plasmid # 67987 ; http://n2t.net/addgene:67987 ; RRID:Addgene_67987) -
For your References section:
A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Tzelepis K, Koike-Yusa H, De Braekeleer E, Li Y, Metzakopian E, Dovey OM, Mupo A, Grinkevich V, Li M, Mazan M, Gozdecka M, Ohnishi S, Cooper J, Patel M, McKerrell T, Chen B, Domingues AF, Gallipoli P, Teichmann S, Ponstingl H, McDermott U, Saez-Rodriguez J, Huntly BJ, Iorio F, Pina C, Vassiliou GS, Yusa K. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079. 10.1016/j.celrep.2016.09.079 PubMed 27760321