Skip to main content

PL552
(Plasmid #68407)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68407 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PL452
  • Backbone manufacturer
    Frederick National Lab
  • Backbone size (bp) 4800
  • Modifications to backbone
    PL552 donor plasmid vector containing a floxed PGK-puromycin expression cassette was constructed by replacing the neomycin gene in the PL452 (Frederick National Lab) with a puromycin gene.
  • Vector type
    Mammalian Expression, Cre/Lox
  • Promoter mouse PGK promoter
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer agctatgaccatgattacg
  • 3′ sequencing primer aaacgacggccagtgaattg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PL552 was a gift from Su-Chun Zhang (Addgene plasmid # 68407 ; http://n2t.net/addgene:68407 ; RRID:Addgene_68407)
  • For your References section:

    Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9. Chen Y, Cao J, Xiong M, Petersen AJ, Dong Y, Tao Y, Huang CT, Du Z, Zhang SC. Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 10.1016/j.stem.2015.06.001. 10.1016/j.stem.2015.06.001 PubMed 26145478