PAX6 sgRNA2
(Plasmid
#68465)
-
Purposetargeting PAX6 gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 68465 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCas9 sgRNA vevctor
-
Backbone manufacturerSu-Chun Zhang (Addgene plasmid# 68463)
- Backbone size w/o insert (bp) 3952
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting PAX6
-
gRNA/shRNA sequenceGTAGATTTTGTATGCACTGC
-
SpeciesH. sapiens (human)
-
GenBank IDNM_000280.4
-
Entrez GenePAX6 (a.k.a. AN, AN1, AN2, ASGD5, D11S812E, FVH1, MGDA, WAGR)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer T7
- 3′ sequencing primer SP6
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PAX6 sgRNA2 was a gift from Su-Chun Zhang (Addgene plasmid # 68465 ; http://n2t.net/addgene:68465 ; RRID:Addgene_68465) -
For your References section:
Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9. Chen Y, Cao J, Xiong M, Petersen AJ, Dong Y, Tao Y, Huang CT, Du Z, Zhang SC. Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 10.1016/j.stem.2015.06.001. 10.1016/j.stem.2015.06.001 PubMed 26145478