-
PurposeRetroviral plasmid with multiple cloning site and puromycin resistance
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 68469 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMSCV
- Total vector size (bp) 6295
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePuromycin Resistance
-
Alt namePuroR
-
Insert Size (bp)603
- Promoter pGK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer GAATTCTACCGGGTAGGGGAG
- 3′ sequencing primer ATCGATGCATGGGGTCGTGCGCTC
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV Puro was a gift from Tyler Jacks (Addgene plasmid # 68469 ; http://n2t.net/addgene:68469 ; RRID:Addgene_68469) -
For your References section:
A Modular Assembly Platform for Rapid Generation of DNA Constructs. Akama-Garren EH, Joshi NS, Tammela T, Chang GP, Wagner BL, Lee DY, Rideout Iii WM, Papagiannakopoulos T, Xue W, Jacks T. Sci Rep. 2016 Feb 18;6:16836. doi: 10.1038/srep16836. 10.1038/srep16836 PubMed 26887506