Skip to main content
Addgene

AAV_NLS-SaCas9-NLS-VPR
(Plasmid #68496)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68496 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA Plasmid #61592
  • Backbone manufacturer
    Feng Zhang
  • Total vector size (bp) 8613
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SaCas9-VPR
  • Alt name
    SauCas9-VPR
  • Species
    Synthetic; Staphylococcus aureus
  • Insert Size (bp)
    4857
  • Promoter CMV
  • Tag / Fusion Protein
    • VPR (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTACTACGAAGTGAATAGCAAGTGC
  • 3′ sequencing primer ACTCAGACAATGCGATGCAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV_NLS-SaCas9-NLS-VPR was a gift from George Church (Addgene plasmid # 68496 ; http://n2t.net/addgene:68496 ; RRID:Addgene_68496)
  • For your References section:

    Cas9 gRNA engineering for genome editing, activation and repression. Kiani S, Chavez A, Tuttle M, Hall RN, Chari R, Ter-Ovanesyan D, Qian J, Pruitt BW, Beal J, Vora S, Buchthal J, Kowal EJ, Ebrahimkhani MR, Collins JJ, Weiss R, Church G. Nat Methods. 2015 Sep 7. doi: 10.1038/nmeth.3580. 10.1038/nmeth.3580 PubMed 26344044