pT3-Neo
(Plasmid
#69123)
-
PurposeSleeping Beauty (SB) transposon with G418 resistance
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69123 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepT3
- Backbone size w/o insert (bp) 4222
- Total vector size (bp) 5017
-
Vector typeMammalian Expression ; Sleeping Beauty transposon
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNeo (codon optimized for human)
-
SpeciesH. sapiens (human)
- Promoter U3MSCV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ACTAACCAATCAGTTCGCTTCTC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT3-Neo was a gift from Martin Bonamino (Addgene plasmid # 69123 ; http://n2t.net/addgene:69123 ; RRID:Addgene_69123) -
For your References section:
An Efficient Electroporation Protocol for the Genetic Modification of Mammalian Cells. Chicaybam L, Barcelos C, Peixoto B, Carneiro M, Limia CG, Redondo P, Lira C, Paraguassu-Braga F, Vasconcelos ZF, Barros L, Bonamino MH. Front Bioeng Biotechnol. 2017 Jan 23;4:99. doi: 10.3389/fbioe.2016.00099. eCollection 2016. 10.3389/fbioe.2016.00099 PubMed 28168187