-
PurposeIntegration of luciferase operon in Tn7 insertion site of Gram negative bacteria
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69150 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGRG25
-
Backbone manufacturerNancy Craig - Johns Hopkins University (Addgene Plasmid #16665)
- Backbone size w/o insert (bp) 12500
- Total vector size (bp) 19671
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameluxCDABE
-
SpeciesPhotorhabdus luminescens
-
Insert Size (bp)6200
-
GenBank IDAF403784
- Promoter frr
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer AATTGCCCGTCGTATTAAAG
- 3′ sequencing primer GTAGCGTCGTAAGCTAATAC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBEN276 was a gift from Pierre Germon (Addgene plasmid # 69150 ; http://n2t.net/addgene:69150 ; RRID:Addgene_69150) -
For your References section:
Development of stable reporter system cloning luxCDABE genes into chromosome of Salmonella enterica serotypes using Tn7 transposon. Howe K, Karsi A, Germon P, Wills RW, Lawrence ML, Bailey RH. BMC Microbiol. 2010 Jul 23;10:197. doi: 10.1186/1471-2180-10-197. 10.1186/1471-2180-10-197 PubMed 20653968