pCSDest2-SpCas9-WT-NLS-3XHA-NLS-ZFP_TS4
(Plasmid
#69227)
-
PurposeExpresses wild type SpCas9 fused to ZFP-TS4 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69227 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCSDest2-SpCas9-NLS-3XHA-NLS
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTS4 ZFP
-
SpeciesSynthetic
-
Tag
/ Fusion Protein
- NLS-3XHA-NLS (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BspEI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CACAGGGATAAGCCCATCAG
- 3′ sequencing primer T3 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCSDest2-SpCas9-WT-NLS-3XHA-NLS-ZFP_TS4 was a gift from Scot Wolfe (Addgene plasmid # 69227 ; http://n2t.net/addgene:69227 ; RRID:Addgene_69227) -
For your References section:
DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Bolukbasi MF, Gupta A, Oikemus S, Derr AG, Garber M, Brodsky MH, Zhu LJ, Wolfe SA. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. 10.1038/nmeth.3624 PubMed 26480473