pLKO1-puro-U6-sgRNA-LRTM2
              
              
                (Plasmid
                
                #69237)
              
            
            
            
          - 
            PurposeU6 driven SpCas9 sgRNA expression for LRTM2 site
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69237 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepLKO.1
- 
              Vector typeMammalian Expression, Lentiviral, CRISPR
- 
                Selectable markersPuromycin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameLRTM2 sgRNA
- 
                    gRNA/shRNA sequenceGCTGGCGGAAGACAGAGTGC
- 
                    SpeciesH. sapiens (human)
- 
                        Entrez GeneLRTM2
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BfuAI (destroyed during cloning)
- 3′ cloning site BfuAI (destroyed during cloning)
- 5′ sequencing primer CGTGACGTAGAAAGTAATAATTTC
- 3′ sequencing primer CCTCGAGCCGCGGCCAAAG (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pLKO1-puro-U6-sgRNA-LRTM2 was a gift from Scot Wolfe (Addgene plasmid # 69237 ; http://n2t.net/addgene:69237 ; RRID:Addgene_69237)
- 
                For your References section: DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Bolukbasi MF, Gupta A, Oikemus S, Derr AG, Garber M, Brodsky MH, Zhu LJ, Wolfe SA. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. 10.1038/nmeth.3624 PubMed 26480473
