Myog'-2A-mCherryNLS-PGK-Puro
(Plasmid
#69548)
-
PurposeDonor vector for homologous recombination to insert a 2A-mCherry-NLS cassette in place of the stop codon of myogenin in the mouse genome.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69548 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePCR2.1
-
Backbone manufacturerInvitrogen
- Total vector size (bp) 7948
-
Vector typeMouse Targeting
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert name2A-mCherry-NLS
-
Alt namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)819
-
Tags
/ Fusion Proteins
- PVT1-2A "skipping" peptide (N terminal on insert)
- 2x nuclear localization signal (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer cttccctgctggtctctgac
- 3′ sequencing primer CACCATCGTGGAACAGTACG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameMyogenin 5' homology arm
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)702
-
MutationSilent V205V mutation in myogenin gene to prevent Cas9-generated double-strand break.
-
GenBank IDNC_000067.6
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer M13-Rev
- 3′ sequencing primer AAGCGCATGAACTCCTTGAT (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameMyogenin 3' homology arm
-
Alt nameMyog
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)675
-
GenBank IDNC_000067.6
-
Entrez GeneMyog (a.k.a. MYF4, bHLHc3, myo)
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer taggtccctcgaagaggttcacta
- 3′ sequencing primer caaggcgattaagttgggtaacgccag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Myog'-2A-mCherryNLS-PGK-Puro was a gift from Charles Gersbach (Addgene plasmid # 69548 ; http://n2t.net/addgene:69548 ; RRID:Addgene_69548)