-
PurposeMLV retroviral vector expressing the hTERT reverse transcriptase immortalizing gene and a tNGFR marker for tracking
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69805 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonexlox dNGFR
-
Backbone manufacturerin lab construct
- Backbone size w/o insert (bp) 6588
- Total vector size (bp) 9987
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl2
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehTERT reverse transcriptase
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3399
-
Entrez GeneTERT (a.k.a. CMM9, DKCA2, DKCB4, EST2, PFBMFT1, TCS1, TP2, TRT, hEST2, hTRT)
- Promoter MLV promoter
-
Tag
/ Fusion Protein
- none
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CTCGATCCTCCCTTTATCCA
- 3′ sequencing primer GCATGCTCCAGACTGCCT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byModified here from a full-length cDNA clone (IMAGE: 5263715) Life Technologies, Carlsbad, CA.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
xlox dNGFR-TERT was a gift from David Ott (Addgene plasmid # 69805 ; http://n2t.net/addgene:69805 ; RRID:Addgene_69805) -
For your References section:
Transduction with human telomerase reverse transcriptase immortalizes a rhesus macaque CD8+ T cell clone with maintenance of surface marker phenotype and function. Andersen H, Barsov EV, Trivett MT, Trubey CM, Giavedoni LD, Lifson JD, Ott DE, Ohlen C. AIDS Res Hum Retroviruses. 2007 Mar;23(3):456-65. 10.1089/aid.2006.0194 PubMed 17411379