-
Purposeencodes a pH-sensitive ratiometric GFP (pH-GFP), which allows for noninvasive measurements of intrabacterial pH in live cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 70045 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneunknown
-
Vector typeMycobacterium tuberculosis expression vector
Growth in Bacteria
-
Bacterial Resistance(s)Hygromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namephGFP
-
Alt namepH-sensitive ratiometric GFP
-
SpeciesSynthetic
-
Insert Size (bp)700
- Promoter mycobacterial promoter Psmyc
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer psmyc1 CGACCAGCACGGCATACATC
- 3′ sequencing primer pBluescript-KS
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The pH-GFP insert in this plasmid contains a F220L mutation compared to the wild-type pHluorin. This difference does not affect function of the pH-GFP.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUV15-pHGFP was a gift from Sabine Ehrt (Addgene plasmid # 70045 ; http://n2t.net/addgene:70045 ; RRID:Addgene_70045) -
For your References section:
A membrane protein preserves intrabacterial pH in intraphagosomal Mycobacterium tuberculosis. Vandal OH, Pierini LM, Schnappinger D, Nathan CF, Ehrt S. Nat Med. 2008 Aug;14(8):849-54. doi: 10.1038/nm.1795. Epub 2008 Jul 20. 10.1038/nm.1795 PubMed 18641659