Skip to main content
Addgene

hJAM-A pcDNA3.1
(Plasmid #70073)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 70073 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 7000
  • Vector type
    Mammalian Expression
  • Selectable markers
    Geneticin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    junctional adhesion molecule-A
  • Alt name
    JAM-A, JAM1, F11R
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1617
  • Entrez Gene
    F11R (a.k.a. CD321, JAM, JAM1, JAMA, JCAM, KAT, PAM-1)
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CMV Forward: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer BGH Reverse: TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Cloned out of an NT2 cDNA library (Stratagene, La Jolla, CA)
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hJAM-A pcDNA3.1 was a gift from Terence Dermody (Addgene plasmid # 70073 ; http://n2t.net/addgene:70073 ; RRID:Addgene_70073)
  • For your References section:

    JAM-A-independent, antibody-mediated uptake of reovirus into cells leads to apoptosis. Danthi P, Hansberger MW, Campbell JA, Forrest JC, Dermody TS. J Virol. 2006 Feb;80(3):1261-70. 10.1128/JVI.80.3.1261-1270.2006 PubMed 16415003