pLenti-Synapsin-pHoenix-WPRE
(Plasmid #70111)

• Purpose: lentiviral expression of pHoenix (Synaptophysin-pHluorin-Arch3-mKate2) driven by human Synapsin I promoter for optogenetic acidification of synaptic vesicles
• Depositing Lab: Christian Rosenmund
• Publication: Rost et al Nat Neurosci. 2015 Nov 9. doi: 10.1038/nn.4161.

Backbone

• Vector backbone: FUGW
• Backbone size w/o insert (bp): 8400
• Total vector size (bp): 11892
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): XL10-gold
• Growth instructions: Researchers should avoid repetitive freeze-thaw cycles when handling the DNA, as we found that this can lead to DNA degradation. Recommended growth strains are XL10gold and Stbl3.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: pHoenix
• Alt name: Synaphtophysin-pHluorin-Arch3-mKate2-betaHK
• Species: R. norvegicus (rat); Halorubrum sodomense, Entacmaea quadricolor, Aequorea victoria
• Insert Size (bp): 3492
• GenBank ID: 24804; KT880224
• Entrez Gene: Syp (a.k.a. Syp1)
• Promoter: Synapsin
• Tags / Fusion Proteins:
  • pHluorin
  • Arch3
  • mKate2
  • H+/K+ ATPase beta-subunit

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: PacI (not destroyed)
• 5′ sequencing primer: CGCTGCCTCAGTCTGCGGTGG
• 3′ sequencing primer: AGGAGCAACATAGTTAAGAATACC

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: Synaptophsin-2xpHluorin: Stephen Heinemann lab, now Addgene plasmid #37004; Arch3: Addgene Plasmid #22222; mKate2: Evrogen
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry